Select Page

by Ali Mackisack

Remember the joys of fossicking around in a river or creek – dipping your net into the water and turning over rocks to discover what was underneath?

New technology takes that joy of discovery even deeper, allowing us to find out exactly what’s in our waterways at a particular moment, even if we can’t see it. Environmental DNA (eDNA) testing is the clever new kid on the block, and that kid’s not only good at detecting tiny bits of genetic material in our waterways, but can also provide us with a picture of exactly what’s in there.

eDNA testing works by extracting tiny bits of DNA from a water sample. These genetic traces from skin or scales, feathers or faeces are then teased out in a lab and their DNA “barcodes” copied thousands of times to make a longer (readable) barcode. Each species has a specific code made up of four chemical bases A, C, G, and T. (That’s adenine [A], cytosine [C], guanine [G], and thymine [T]) for the scientifically-curious among us.) These biological barcodes are compared to a reference database which matches each sequence to the unique code for each species.

So, who would have thought it, but according to this eDNA testing, there’s a tiny freshwater jellyfish, Craspedacusta sowerbii living somewhere in the upper reaches of the Waipoua River. This native of China is otherwise known by it’s code name TAACTATATTCTCGATCCACAACTTACCCTATGAAGATAGGAGTGCATCGAGAGTGGTAGTTTG.

Fortunately, the team at Wilderlab in Wellington – New Zealand’s only exclusive eDNA testing laboratory – can do all the sequencing side of things, and provide users with a chart that lists and illustrates the species detected. They’re also working on a programme which will enable each user group to display their results as a “Wheel of Life” such as the one seen here, which beautifully illustrates the results of a sample taken from the Ruakōkoputuna River.

While eDNA can’t accurately inform how much or how many of something is in our waterways, it’s a sensitive and accurate tool which can give a snapshot of what is or isn’t there. At the moment it’s being used to detect Covid-19 in wastewater, but increasingly it’s being used by scientists, farmers, conservation groups and schools as a window into their waterways.

“For us it means that Community Catchments can now quickly establish freshwater ecological baselines in their catchments and continue to measure improvements over time,” says Jim O’Malley of Sustainable Wairarapa Inc.

“We were interested in what was and wasn’t in the river,” says Nigel Boniface, a member of the Atiwhakatu (Donnelly’s Flat) Trapping Project which took a sample earlier this year. “There were a few surprises – the indication of a strong presence of wētā being one of them. We’d like to look again in 5 years or so and see how things are changing. We’re interested too, in the testing which Wilderlab is developing, that captures 24 hours worth of eDNA in a larger filter, which would give us an even clearer picture of what’s up there under the ranges.”

Gill Murray, whose Upper Waipoua Catchment Group’s test revealed the presence of the jellyfish, says the test was an easy way to get a large amount of detailed data in one go. “The potential of this, to give us a detailed picture of what’s happening in our waterways over time, has got people really excited,” she says.

To find out more, Wilderlab’s website is a great place to start.

Wheel Of Life (Wilderlab)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Photo: Wheel of Life results from the Ruakōkoputuna River (Source: Wilderlab)